Wybierz swoją tapetę: Wybierz swoją tapetę: Zaloguj się, aby zapisać zmiany Zamknij
Forum Sklep Donate
Huntington's Disease Youth Organization

Gen choroby Huntingtona: Pod mikroskopem

Na stronie internetowej HDYO znajdziesz więcej przydatnych informacji o HD, które skierowane są do młodzieży, rodziców i specjalistów. Zajrzyj:

www.hdyo.org

Choroba Huntingtona spowodowana jest wydłużeniem konkretnego genu w DNA danej osoby. Ten artykuł opisuje ten gen oraz jego wydłużoną wersję. W celu lepszego zilustrowania sposobu dziedziczenia i przekazywania genu, wykorzystamy drzewa genealogiczne.

Geny, chromosomy i DNA

DNA, chromosomes and genes

Na początku warto wytłumaczyć podstawy, zaczynając od DNA. Jest to związek chemiczny, z którego składają się nasze geny. „DNA” to skrót od jakże chwytliwej angielskiej nazwy Deoxyribonucleic Acid (kwas deoksyrybonukleinowy). Raczej nie dziwi fakt, że w zasadzie nikt nie używa pełnej nazwy – DNA o wiele łatwiej zapamiętać i wymówić.

DNA to dane, które dziedziczymy po naszych rodzicach, a które oni odziedziczyli po swoich itd. Nasz DNA decyduje o tym, kim jesteśmy, jak wyglądamy i w jaki sposób dorastamy. Takie cechy, jak kolor włosów i oczu, wzrost, płeć, a nawet pewne aspekty osobowości są całkowicie uwarunkowane właśnie przez nasz DNA.

DNA to nazwa związku chemicznego, natomiast o genach mówimy, że są zbiorem instrukcji przechowywanym w DNA. Posiadamy mnóstwo genów – około 23 tysięcy – znajdujących się w komórkach naszego ciała. Każdy gen to zbiór instrukcji – podobnych do tych w przepisach kulinarnych. Gen instruuje komórkę, jak wygenerować związek chemiczny zwany białkiem. Białka to machineria odpowiedzialna za bardzo ważne zadania komórek, począwszy od stwarzania warunków dla zachodzenia reakcji chemicznych, skończywszy na przekazywaniu informacji od jednej komórki do drugiej.

Geny połączone są ze sobą w taki sposób, że przypominają małe kiełbaski, które są zapakowane w pojemniki - całość nazywamy chromosomami. W sumie jest 46 chromosomów. 23 pochodzą od jednego rodzica i 23 od drugiego. Każda komórka w naszym ciele zawiera kopię wszystkich 46 chromosomów.

Mutacje genetyczne: Gen choroby Huntingtona

Skoro omówiliśmy już podstawy, przyjrzyjmy się teraz genowi odpowiedzialnemu za chorobę Huntingtona. Czasem w chromosomach czy genach zachodzą zmiany (przez naukowców nazywane „mutacjami”). Zmiany te mogą wpływać na funkcjonowanie naszego organizmu i powodować choroby genetyczne. Nawet najmniejsza mutacja genu może doprowadzić do drastycznej zmiany w strukturze białka. Wyobraź sobie przepis kulinarny, który kazałby kucharzowi piec ciasto 400 minut zamiast 40, wtedy zrozumiesz, jak zwykła „literówka” w zapisie naszych genów może wywołać wielkie problemy.

W roku 1993 grupa naukowców odkryła gen odpowiedzialny za chorobę Huntingtona – na chromosomie 4. Zauważyli, że pewna część genu powtarza się, niczym zacinająca się osoba, czy ktoś, kto przytrzymał za długo literkę na klawiatuuuuuuuuuuuuuuuuuuuuuuuuurze. Powtórzenie to właśnie powoduje rozwój choroby Huntingtona i nazywa się fachowo „powtórzeniami CAG”.

Czym są „powtórzenia CAG”?!

CAG repeats

Jeśli nadal nie wiesz, dlaczego „zacinanie się” genu choroby Huntingtona nazywamy powtórzeniami CAG, już wyjaśniamy. Podobnie jak „DNA”, jest to skrót od trudnych słów. Ogólnie rzecz biorąc, DNA składa się z czterech części, są to: adenina (w skrócie A), cytozyna ( C ), guanina ( G ) i tymina ( T ). Te właśnie składniki stanowią kod DNA i genów. Każdy gen posiada osobny kod, a naukowcy - cóż, są leniwi i nie chce im się zapisywać kodu używając skomplikowanych nazw wspomnianych składników w całości, więc używają skrótów. Zatem cztery powyższe części składowe DNA to właśnie A, C, G i T, tak że gdyby ktoś miał rozpisać kod genu, wyglądałby on przykładowo w ten sposób: AAGTCCTGACTGGGACCTTGAGACCTAG

Jeśli gen przypomina kulinarny przepis, to wspomniane części składowe są jak litery, które tworzą wyrazy składające się na zawarte w nim instrukcje. Alfabet, którym posługują się geny jest bardzo prosty, wybierać można tylko spośród czterech liter. Jednak równie ważny jest układ tych liter.

Gen powodujący chorobę Huntingtona posiada fragment, w którym składniki C, A i G powtarzają się wiele razy – tzw. „powtórzenia CAG”. Większość kopii tego genu zawiera od 10 do 20 powtórzeń, ale czasami powtórzenia te wydłużają się – i to jest właśnie źródło problemu.

Powtórzenia CAG

Każdy człowiek posiada dwie kopie genu odpowiedzialnego za chorobę Huntingtona (niezależnie od tego, czy należy do grupy ryzyka zachorowania na tę chorobę, czy też nie). Każdy z obojga rodziców przekazuje jedną kopię genu, a każdy gen choroby Huntingtona zawiera w sobie powtórzenia CAG.

To właśnie liczba powtórzeń CAG decyduje o tym, czy choroba się rozwinie. Krótko mówiąc, ludzie, którzy zapadają na chorobę Huntingtona odziedziczyli dłuższe, zmutowane, powtórzenia CAG niż ci, którzy pozostaną zdrowi. By łatwiej było to wszystko zrozumieć, podzielmy konkretne liczby powtórzeń CAG na cztery różne przedziały.

26 i mniej (przedział niechorobowy, bez ryzyka wystąpienia choroby)

Jak już pisaliśmy, wszyscy ludzie posiadają powtórzenia CAG w swym genie choroby Huntingtona (nawet ci z rodzin w ogóle niedotkniętych chorobą Huntingtona). Większość osób, które nie mają choroby Huntingtona posiada około 10-20 powtórzeń CAG. Tak naprawdę każda liczba powtórzeń CAG, która jest poniżej 26 jest dobra i oznacza, że nie trzeba się martwić. Jeśli jednak liczba jest wyższa, mogą pojawić się komplikacje.

40 powtórzeń i więcej (przedział chorobowy)

Każda osoba z 40 lub więcej powtórzeniami CAG na pewno prędzej czy później zapadnie na chorobę Huntingtona, mając przy tym także 50% ryzyko przekazania genu każdemu ze swych dzieci. Najwięcej ludzi cierpiących na Huntingtona posiada pomiędzy 40 a 50 powtórzeń CAG.

Powtórzenia z przedziału 27-39 są dość rzadkie. Nie są one też takie oczywiste i właściwie naukowcy nie do końca je zgłębili, nazywa się je zatem „szarą strefą”.

27-35 powtórzeń CAG (ryzyko dla kolejnych pokoleń)

Dobra wiadomość na temat liczby powtórzeń pomiędzy 27-35 jest taka, że osoba sama nie zachoruje na chorobę Huntingtona. Jednakże, istnieje małe prawdopodobieństwo (ok. 5%), że jej potomstwo może być w grupie ryzyka choroby Huntingtona. Dzieje się tak dlatego, że powtórzenia w tym przedziale mogą wydłużyć się, gdy są wraz z genem przekazywane dziecku - mogą stać się na tyle mnogie, że wejdą już w tę kategorię, która skazuje dziecko na zachorowanie.

36-39 powtórzeń CAG (zakres obniżonej penetracji)

Osoby z powtórzeniami mieszczącymi się w tym przedziale być może zachorują, ale nie musi tak się stać. Może się zdarzyć, że zaobserwują u siebie objawy choroby Huntingtona w bardzo późnym wieku. Czasem może być to tak późno, że umrą przed pojawieniem się jakichkolwiek objawów choroby Huntingtona. Tak czy inaczej, w tej kategorii ryzyko przekazania choroby potomstwu nadal wynosi 50%. Naukowcy nazywają opisaną tu nieprzewidywalność mianem „obniżonej penetracji”.

Czy wiesz, że… To właśnie powtórzenia CAG są mierzone przez diagnostów laboratoryjnych, gdy ludzie decydują się wykonać test genetyczny na obecność choroby Huntingtona.

Dziedziczenie „wydłużonej” wersji genu choroby Huntingtona

To należy wiedzieć: jeśli gen odpowiedzialny za chorobę Huntingtona ma zbyt wiele powtórzeń CAG, wywołuje chorobę Huntingtona. Teraz przyjrzyjmy się, jak jest dziedziczona wydłużona wersja genu i jak choroba Huntingtona może być przekazywana w rodzinie.

Ryzyko 50%

50% risk

Ci, którzy odziedziczyli wydłużoną wersję genu od rodziców, zachorują na chorobę Huntingtona. Ponieważ rodzice przekazują nam po jednym chromosomie z każdej pary, w sumie mamy dwie kopie każdego z genów – jedną od mamy, drugą od taty.

Dlatego też osoba z chorobą Huntingtona ma dwie kopie genu odpowiedzialnego za chorobę Huntingtona – jedną, która jest wydłużona (z wieloma powtórzeniami CAG) i drugą, która jest normalna.

Osoba bez choroby Huntingtona również ma dwie kopie genu odpowiedzialnego za chorobę Huntingtona, ale obie są normalne.

Tak więc dziecko, którego jeden z rodziców ma chorobę Huntingtona, posiada jeden normalny gen od zdrowego rodzica, ale odziedziczy również jedną z dwóch: wydłużoną lub normalną wersję genu od chorego rodzica.

Z tego wynika 50-procentowe ryzyko odziedziczenia wydłużonej wersji genu.

Jeśli chodzi o przekazywanie genów, to możliwe są cztery sytuacje (jak to pokazuje ilustracja). Dwie z nich to przekazanie dziecku wydłużonej wersji genu, dwie kolejne to przekazanie genu prawidłowego – tak więc szanse na otrzymanie każdej z kopii genu wynoszą 50%. Żeby uprościć tok naszego rozumowania, wykluczmy z niego zdrowego rodzica i skupmy się na tym, czy dziecko otrzymuje normalny czy wydłużony gen od rodzica z chorobą Huntingtona. Niezmiennie – nadal mamy 50-procentowe ryzyko.

To, czy ktoś dziedziczy normalną czy wydłużoną wersję genu, jest całkowicie przypadkowe i dlatego właśnie niektórzy mówią, że jest to jak rzut monetą. Ponadto, każdy ma swoje własne 50% ryzyko, swój własny rzut monetą decydujący o wyniku.

Prawdopodobieństwo 25%

25% grandchild risk

Nie zawsze jednak możemy w ten prosty sposób stwierdzić, że ryzyko wynosi po prostu 50%. Jeśli na przykład któryś z dziadków danego dziecka chorował na chorobę Huntingtona, ale rodzic tego dziecka nie poddał się testowi genetycznemu, wówczas to dziecko ma 25-procentowe prawdopodobieństwo odziedziczenia mutacji.

Wynika to z faktu, że nie możemy stwierdzić, czy rodzic dziecka, o którym mowa, odziedziczył wydłużony gen, czy też nie. Jeśli rodzic miałby wadliwy gen, wtedy ryzyko zachorowania u dziecka wynosiłoby 50%.

Jeśli jednak okazałoby się, że ten rodzic nie ma wydłużonej wersji genu, wówczas ryzyko z 25% zmniejsza się do 0% - dziecko będzie zdrowe. Wszystko zależy od genów, które odziedziczył rodzic dziecka. Dopóki tego nie wiemy, dziecko ma 25% ryzyka zachorowania na HD.

Dziedziczenie autosomalne dominujące

Jak to się dzieje, że gdy dana osoba ma jeden gen normalny, a drugi wydłużony, to właśnie wydłużona wersja genu przejmuje kontrolę i powoduje chorobę Huntingtona? Dlaczego normalny gen nie próbuje odeprzeć ataku? Cóż, wystarczy zwrócić uwagę na termin „dziedziczenie autosomalne dominujące”. Niestety choroba Huntingtona jest właśnie określana nazwą „choroba autosomalna dominująca”, co oznacza, że gdy choć jedna z dwóch kopii genu jest wydłużona, choroba się ujawni. Innymi słowy – gen powodujący chorobę Huntingtona dominuje nad normalnym genem. Dlatego też wystarczy tylko jego jedna wydłużona wersja, by spowodować chorobę.

Ogólnie rzecz ujmując ta sekcja wyjaśnia, że gen powodujący chorobę Huntingtona jest wydłużony, ponieważ jest w nim za dużo „powtórzeń CAG” (zakres tych powtórzeń mieści się w czterech przedziałach). Przyjrzeliśmy się ryzyku odziedziczenia choroby Huntingtona i temu, jak ten mechanizm działa. Pomimo niektórych bardziej skomplikowanych terminów, jak np. „dziedziczenie autosomalne dominujące”, mamy nadzieję, że więcej wytłumaczyliśmy niż „namąciliśmy”. Jeśli jednak masz jakieś pytania, koniecznie skorzystaj z działu Zadaj pytanie, w którym rzetelnych odpowiedzi udzielają nasi eksperci. Możesz też bezpośrednio skontaktować się z HDYO, jeśli nie chcesz zadawać pytania publicznie.